• Users Online: 6514
  • Home
  • Print this page
  • Email this page


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2022  |  Volume : 11  |  Issue : 1  |  Page : 70-74

Changes of th1 and th2 cytokines levels among sudanese tuberculosis patients during treatment


1 Department of Medical Microbiology, College of Medical Laboratory Science, Sudan University of Science and Technology, Khartoum, Sudan
2 Department of Medical Microbiology, College of Medical Laboratory Science, Sudan University of Science and Technology, Khartoum, Sudan; Department of Medical Laboratories Technology, College of Applied Medical Sciences, Taibah University, Al-Madinah, Saudi Arabia
3 Department of Medical Laboratories Technology, College of Applied Medical Sciences, Taibah University, Al-Madinah, Saudi Arabia
4 Department of Microbiology, College of Medicine, King Khalid University, Abha, Saudi Arabia
5 Diabetes and Endocrine center, Military Hospital, Khamis Mashit, Saudi Arabia
6 Molecular section, National Council for Research, Khartoum, Sudan

Date of Submission13-Dec-2021
Date of Decision29-Dec-2021
Date of Acceptance24-Jan-2022
Date of Web Publication12-Mar-2022

Correspondence Address:
Miskelyemen A Elmekki
Department of Medical Microbiology, College of Medical Laboratory Science, Sudan University of Science and Technology, Khartoum
Sudan
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmy.ijmy_245_21

Rights and Permissions
  Abstract 


Background: The interaction of T cells with infected macrophages depends on the interplay of cytokines produced in each cell, and this mechanism is a key to protective immunity against Mycobacterium tuberculosis. Extensive research has been devoted to studying the changes in systemic cytokine levels in patients with tuberculosis (TB), but the results are inconclusive. Determine Th1 and Th2 cytokine immune response levels among new TB patients compared to follow-up and healthy control. Design: Cross-sectional laboratory-based study. Setting: Immunology Laboratory, National Center for Research. Methods: Blood samples (n = 145) were collected from confirmed new TB cases, follow-up TB cases, and from healthy controls. Participants were initially diagnosed by microcopy using Ziehl–Neelsen smear method and confirmed by polymerase chain reaction using IS6110. Cytokine levels (interleukin-10 [IL-10], tumor necrosis factor alpha [TNF-α], and Interferon-gamma [IFN-γ]) were measured directly from plasma using sandwich enzyme-linked immunosorbent assay. Main Outcome Measures: Measuring Th1 cytokines (IFN-γ and TNF-α) and Th2 cytokine (IL-10). One hundred and forty-five cases (new TB cases, 85; follow-up, 25; and healthy control, 35) were included in this study. Results: The study population were mainly males (70.3%) compared to females (29.7%) and 87.5% aged between 21 to 60 year. The plasma IFN-γ levels were found significantly higher in new TB cases (mean 35.38 pg/m; confidence interval: 29.32–41.43) than in the follow-up patients and the healthy control (P = 0.000). There were no significant differences in TNF-α and IL-10 levels among the new TB cases and the follow-up and healthy control (P = 0.852 and P = 0.340, respectively). Conclusions: Direct plasma IFN-γ level can be used in TB patient follow-up as a recovery marker as it correlated well with the appearance of the disease and treatment response.

Keywords: Interferon-gamma, interleukin-10, pulmonary tuberculosis, Sudan, tumor necrosis factor-alpha, Ziehl–Neelsen method


How to cite this article:
Abdul-Aziz AA, Elhassan MM, Yousuf AM, Hamid ME, Abdulsalam SA, Gafar RA, Elmekki MA. Changes of th1 and th2 cytokines levels among sudanese tuberculosis patients during treatment. Int J Mycobacteriol 2022;11:70-4

How to cite this URL:
Abdul-Aziz AA, Elhassan MM, Yousuf AM, Hamid ME, Abdulsalam SA, Gafar RA, Elmekki MA. Changes of th1 and th2 cytokines levels among sudanese tuberculosis patients during treatment. Int J Mycobacteriol [serial online] 2022 [cited 2022 May 21];11:70-4. Available from: https://www.ijmyco.org/text.asp?2022/11/1/70/339515




  Introduction Top


Cytokines are small protein molecules that regulate immunological responses at the cellular level, and they stimulate and recruit a wide range of cells involved in immunity and inflammation. Interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), and interleukin-12 (IL-12) are the key cytokines involved in controlling Mycobacterium tuberculosis infections.[1] It has been reported that IL-2, IFN-γ, and TNF-α expression profiles of CD4+ T cells are promising for the detection of active tuberculosis (TB) disease.[1],[2]

In M. tuberculosis-infected patients IFN-γ levels positively correlate with the severity of pulmonary disease, and that increasing the per capita production of IFN-γ leads to the great pathology while suppression of IFN-γ is essential to prevent lethal disease.[3] A recent study found that quantitative parameters of IFN-γ secretion play a minor role in determining the course of TB disease but mirror the activity of the infectious process.[4] Similarly, it was suggest that M. tuberculosis-specific TNF-α could be a potential biomarker for the diagnosis of active TB disease.[5] Other data have shown that TNF-α blockade, by the use of TNF-deficient mice or anti-TNF-α drugs, induced delayed formation of granuloma, necrosis, disorganization, or disintegration of granuloma structures.[6],[7] Kapoor et al.[8] showed that treatment of in vitro M. tuberculosis granuloma with anti-TNF-α was associated with the reactivation of latent M. tuberculosis.[9] TNFα has recently been proposed as a biomarker to distinguish between active pulmonary disease and latently infected patients who do not exhibit disease symptoms. Using polychromatic flow cytometric analysis, patients with pulmonary TB disease have a higher proportion of single positive TNFα-producing M. tuberculosis-specific CD4+ T cells compared to individuals with latent infection.[2] Antigen-specific IL-10 production is found in pulmonary TB patients and along with TNF-α production can be used to reliably distinguish between latent TB and pulmonary TB.[10] Moreover, a recent study from Nigeria found higher levels of TNF-α and IFN-γ in TB patients compared to control, and the levels of IFN-γ were even significantly higher in those who were found drug-susceptible compared to drug-resistant during follow-up.[11] Thus, both cytokines might be used as indicators for response to anti-tubercular therapy, given the fact that their levels drop significantly during follow-up in patients responding to treatment.[12]. However, different results were revealed by another study for IFN-γ, which was found to increase significantly following successful treatment.[13]

IL-10 is linked with the ability of M. tuberculosis to evade immune responses and mediate long-term infections in the lung.[14] TGFβ plays an inhibitory role in host responses to M. tuberculosis infection as it is able to induce IL-10 and to synergize with this cytokine to suppress IFNγ production.[14]

The aim of the present study was to compare the levels of Th1 cytokines (IFN-γ and TNF-α) and Th2 cytokines (IL-10) among active TB patients, follow-up patients (i.e., those undergoing treatment), and healthy controls.


  Methods Top


Ethics

This study was approved by the Ethical Committee of Sudan University of Science and Technology (project No 4703/017. dated February 14, 2017) and the ethical committee of the Federal Ministry of Health, Sudan. Samples collection was conducted according to Helsinki Declaration of 1975 (Revised 2000). All participants were given their informed consent and those below 10 years old the assent was taken from their parents/gardeners.

Study type and sample collection

This is a cross-sectional laboratory-based study. Blood samples were collected from 145 participants comprising new TB cases (n = 85), follow-up TB patients (n = 25), and healthy control (n = 35). The samples were collected between May and October 2017 from Abu Anja Chest Disease Hospital and Omdurman Tropical Disease Hospital, Sudan.

Questionnaire and informed consent

A standardized questionnaire was used to collect the following demographic data: Patient gender, age, nationality, disease site, and smear result of the study subjects, history of previous TB infection or TB treatment. Study participants provided informed consent. Blood samples were collected in heparinized tubes. Plasma was separated by centrifugation, transferred to Eppendorf tubes, and stored at ≤−20°C until use.

Ziehl–Neelsen method

Ziehl–Neelsen staining (ZN) was done following standard methods.[15] Purulent parts of sputum specimen were selected. A loopful of sputum was spread on clean glass slide. Smear was left to dry completely and fixed by passing through the flame carefully. The proper temperature for flame fixation was checked by touching the slide to the back of the hand immediately after removing it from the flame. Smear was covered with carbol fuchsin and heated gently until vapor rose; the heated stain was left for 5 min and washed off with clean water. Decolourization was done by 3% acid alcohol for 20 s, washed and then methylene blue was added for 2 min, washed, dried, and examined under microscope. For indirect ZN from culture similar procedure was performed.

Polymerase chain reaction amplification and gel electrophoresis of the IS6110 sequence

DNA was extracted by phenol–chloroform method. The primers used and the polymerase chain reaction (PCR) methodology were those described by Thierry et al.[16] to amplify a target IS6110 fragment of 123 base pairs (bp). The primers used had the following sequences: CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG. The amplified DNA target (123 bp) was visualized by electrophoresis on 1.8% agarose gel stained with ethidium bromide and observed under UV light.

Measurement of cytokines using sandwich enzyme-linked immunosorbent assay

The lyophilized standards of IFN-γ, TNF-α, and IL-10 cytokines were reconstituted and serial dilutions were prepared according to the manufacturer's instructions (ELISA Max™ Deluxe Set, BioLegend, Barcelona, Spain). Levels of circulating cytokines were determined by sandwich ELISA (BioLegend) for IFN-γ, TNF-α, and IL-10. The protocol was performed according to the manufacturer's instructions.

Enzyme-linked immunosorbent assay

Sandwich ELISA was used to determine the concentration of cytokines IFN-γ, TNF-α, and IL-10, according to the manufacturer's instructions.

Data analysis

SPSS software (v. 16, SPSS Inc., Chicago, IL, USA) was used for data analysis. Descriptive statistics were used to characterize the data, and differences in categorical variables between groups were compared using the Chi-squared test. A two-sided P < 0.05 was considered statistically significant.


  Results Top


Demographic data of tuberculosis patients

Demographic data and TB history of the 145 participants are shown in [Table 1]. The study population were mainly males (70.3%) compared to females (29.7%) and 87.5% aged between 21 and 60 years. Of the 145 patients, 85 were new TB patient with positive ZN smear, 25 were follow-up cases and 35 were TB-negative control.
Table 1: Tuberculosis history of the 145 participants from Khartoum, Sudan, and their demographic data

Click here to view


Cytokine levels among tuberculosis patient in comparison to follow-up and healthy control

The mean concentrations of IL-10, IFN-γ, and TNF-α in positive new TB cases, follow-up cases, and healthy control participants are shown in [Table 2] and [Figure 1]. The plasma IFN-γ levels were found significantly higher in new TB cases (mean 35.38 pg/m; confidence interval: 29.32–41.43) than in the follow-up patients and the healthy control (P = 0.000). There were no significant differences in TNF-α and IL-10 levels among the new TB cases and the follow-up and healthy control (P = 0.852 and P = 0.340, respectively).
Table 2: Descriptive statistics of the plasma cytokine levels (interferon gamma, tumor necrosis factor-alpha, and interleukin-10) among tuberculosis patient in comparison to follow-up cases and healthy control

Click here to view
Figure 1: Average interferon gamma, tumor necrosis factor-alpha and Interleukin-10 levels (pg/mL) in the tuberculosis cases compared to healthy control

Click here to view



  Discussion Top


Immune response to M. tuberculosis is largely mediated by the bacteriostatic and bactericidal function of cytokine-activated macrophages. TNF-α, mainly produced by macrophages, upregulates the microbicidal activity against mycobacteria in human monocytes or monocyte-derived macrophages.[4] IFN-γ acts as a powerful macrophage activator. It potentiates cell response, including cytokine and nitric oxide production, and increases cytolytic activity, especially for the Th1 type.[5]

The population of this study included 145 subjects, 85 of which (58.6%) had positive ZN smears while 25 (17.2%) had negative smears, but positive PCR results (follow-up group) and 35 (24.1%) were healthy controls. Blood was withdrawn to measure direct plasma cytokine levels (IL-10, TNF-α, and IFN-γ). In this study, direct plasma IFN-γ levels were significantly higher in new TB cases than in healthy controls (P < 0.0001). These results are consistent with Hussain et al.[17] in Pakistan. Follow-up patients had significantly higher IFN-γ levels than healthy controls (P = 0.003). This result indicates that, although IFN-γ levels decreased after treatment, they remained significantly elevated relative to healthy controls. Nie et al.[18] similarly reported that IFN-γ decreased after 2 months of therapy.

Direct plasma IL-10 in positive new cases was lower than in follow-up patients. This increase in IL-10 levels after initiation of anti-TB treatment has been reported by Butov et al.,[19] who found that after 2 months of anti-TB therapy, IL-10 levels significantly increased in follow-up cases compared to the beginning of therapy (follow-up after 2 months), however, the increase was not significantly different (P < 0.340). A previous study found that the levels of IL-10 are usually elevated in the serum of the pulmonary TB patients.[20] Different studies concluded that IL-10 may play a role in limiting the immune response to Mtb, contributing to TB pathogenesis.[21],[22] Another study also correlated the levels of circulating IL-10 to the degree of severity of TB, concluding that they were directly proportional.[23]

Direct TNF-α levels were not significantly different between new TB cases and the healthy controls (P = 0.852). In contrast, Harari et al.[2] found that distinguishing between active and latent TB infection can be done through TNF-α as a biomarker, which was found highly produced in patients with active infection. TNF-α is well known for its role in controlling the M. tuberculosis infection, as well as causing severe tissue damage, due to its complex network of interactions.[24] Moreover, a meta-analysis study concluded that the risk of TB may be significantly increased in patients treated with TNF-α antagonists, which confirms the role of this cytokine in controlling the diseases.[25] Another study also found high levels of TNF-α in the serum and pleural effusion fluid of TB patients, suggesting its ability to differentiate between benign and malignant pleural disease.[26]

Yamada et al.[27] commented briefly on the conflicting results on cytokine in response to TB. For example, M. tuberculosis antigen-stimulated peripheral blood cells from TB patients produced high or normal levels of IL-4 and IL-10. However, the same authors reported conflicting results in different populations. While different culture conditions in vitro may explain some discrepancies, they concluded, they can result primarily from differences in the intrinsic immune response of patient populations. First, malnutrition unrelated to TB can markedly affect cytokine production.[27] Second, asymptomatic parasitic infections in patients with TB upregulate type 2 cytokines and inhibit the type 1 cytokine response.[28] Third, the severity of TB can affect the cytokine response. Studies have shown that patients with less severe forms of pulmonary TB predominantly produce Th1 cytokines such as IFN-γ. In contrast, the increase in IL-4 levels, a Th2 type cytokine, is related to disease severity.[16] Fourth, the cytokine response changes during therapy so that results obtained in the early phases of treatment differ from later responses.[23] Investigators should consider these factors in designing and interpreting future studies to understand the relationship between type 1 cytokines and TB pathogenesis. Some of these factors may be associated with the genetic susceptibility, as shown in a previous finding regarding IFNγ gene polymorphisms in the Sudanese population.[29] Another factor that may be considered is the comorbidities, especially with chronic diseases, such as diabetes. It was found that pro-inflammatory cytokine production is greatly enhanced by such conditions.[30]

In conclusion, cytokine responses observed in follow-up TB patients changed with therapy. In the direct measurement of cytokines from plasma, Sudanese TB patients in this study produced high levels of IFN-γ. These results are consistent with the published literature. However, the patients produced less IL-10 and similar amounts of TNF-α which differs from previous reports for those two cytokines, and further studies are required.

We recommend that interpreting cytokine levels requires careful consideration of many factors, including TB severity and duration of treatment, considering drug susceptibility. Moreover, direct plasma IFN-γ levels can be used in the follow-up of TB patients as a marker of recovery as it correlated well with the activity of the disease and response to treatment. A larger study is needed to confirm these results.

Limitations

Further studies about immunity to TB in Sudan are needed. The drug susceptibility should also be considered. More Th1 cytokines such as IL-12 and Th2 cytokines, such as TGFβ can also be analyzed. A study that investigates Th17 response will also be an interesting addition regarding knowledge in TB immunity in Sudan.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

Ethical clearance

This project was ethically approved by the ethical committee of Sudan University of Science and Technology and by the ethical committee of the Federal Ministry of Health, Khartoum, Sudan. The participants were given their informed consent.



 
  References Top

1.
Cooper AM, Mayer-Barber KD, Sher A. Role of innate cytokines in mycobacterial infection. Mucosal Immunol 2011;4:252-60.  Back to cited text no. 1
    
2.
Harari A, Rozot V, Bellutti Enders F, Perreau M, Stalder JM, Nicod LP, et al. Dominant TNF-α+ Mycobacterium tuberculosis-specific CD4+T cell responses discriminate between latent infection and active disease. Nat Med 2011;17:372-6.  Back to cited text no. 2
    
3.
Sakai S, Kauffman KD, Sallin MA, Sharpe AH, Young HA, Ganusov VV, et al. CD4 T cell-derived IFN-γ plays a minimal role in control of pulmonary Mycobacterium tuberculosis infection and must be actively repressed by PD-1 to prevent lethal disease. PLoS Pathog 2016;12:e1005667.  Back to cited text no. 3
    
4.
Nikitina IY, Panteleev AV, Sosunova EV, Karpina NL, Bagdasarian TR, Burmistrova IA, et al. Antigen-specific IFN-gamma responses correlate with the activity of M. tuberculosis infection but are not associated with the severity of tuberculosis disease. J Immunol Res 2016;2016:7249369.  Back to cited text no. 4
    
5.
Wang F, Hou H, Xu L, Jane M, Peng J, Lu Y, et al. Mycobacterium tuberculosis-specific TNF-α is a potential biomarker for the rapid diagnosis of active tuberculosis disease in Chinese population. PLoS One 2013;8:e79431.  Back to cited text no. 5
    
6.
Kindler V, Sappino AP, Grau GE, Piguet PF, Vassalli P. The inducing role of tumor necrosis factor in the development of bactericidal granulomas during BCG infection. Cell 1989;56:731-40.  Back to cited text no. 6
    
7.
Roach DR, Bean AG, Demangel C, France MP, Briscoe H, Britton WJ. TNF regulates chemokine induction essential for cell recruitment, granuloma formation, and clearance of mycobacterial infection. J Immunol 2002;168:4620-7.  Back to cited text no. 7
    
8.
Kapoor N, Pawar S, Sirakova TD, Deb C, Warren WL, Kolattukudy PE. Human granuloma in vitro model, for TB dormancy and resuscitation. PLoS One 2013;8:e53657.  Back to cited text no. 8
    
9.
Tebruegge M, Dutta B, Donath S, Ritz N, Forbes B, Camacho-Badilla K, et al. Mycobacteria-specific cytokine responses detect tuberculosis infection and distinguish latent from active tuberculosis. Am J Respir Crit Care Med 2015;192:485-99.  Back to cited text no. 9
    
10.
Redford PS, Murray PJ, O'Garra A. The role of IL-10 in immune regulation during M. tuberculosis infection. Mucosal Immunol 2011;4:261-70.  Back to cited text no. 10
    
11.
Bolajoko EB, Arinola OG, Odaibo GN, Maiga M. Plasma levels of tumor necrosis factor-alpha, interferon-gamma, inducible nitric oxide synthase, and 3-nitrotyrosine in drug-resistant and drug-sensitive pulmonary tuberculosis patients, Ibadan, Nigeria. Int J Mycobacteriol 2020;9:185-9.  Back to cited text no. 11
[PUBMED]  [Full text]  
12.
Waghmare PJ, Lende T, Goswami K, Gupta A, Gupta A, Gangane N, et al. Immunological host responses as surveillance and prognostic markers in tubercular infections. Int J Mycobacteriol 2019;8:190-5.  Back to cited text no. 12
[PUBMED]  [Full text]  
13.
Mvungi HC, Mbelele PM, Buza JJ, Mpagama SG, Sauli E. Blood cytokine responses to early secreted protein antigen-6/culture filtrate protein-10 tuberculosis antigens 2 months after antituberculosis treatment among patients with drug-susceptible pulmonary tuberculosis. Int J Mycobacteriol 2019;8:53-9.  Back to cited text no. 13
[PUBMED]  [Full text]  
14.
Domingo-Gonzalez R, Prince O, Cooper A, Khader SA. Cytokines and chemokines in Mycobacterium tuberculosis infection. Microbiol Spectr 2016;4. [doi: 10.1128/microbiolspec.TBTB2-0018-2016].  Back to cited text no. 14
    
15.
Murray PR. Manual of Clinical Microbiology. Washington, D.C.: ASM Press; 2007.  Back to cited text no. 15
    
16.
Thierry D, Cave MD, Eisenach KD, Crawford JT, Bates JH, Gicquel B, et al. IS6110, an IS-like element of Mycobacterium tuberculosis complex. Nucleic Acids Res 1990;18:188.  Back to cited text no. 16
    
17.
Hussain S, Afzal N, Javaid K, Ullah MI, Ahmad T, Saleem-Uz-Zaman. Level of interferon gamma in the blood of tuberculosis patients. Iran J Immunol 2010;7:240-6.  Back to cited text no. 17
    
18.
Nie W, Wang J, Jing W, Shi W, Wang Q, Huang X, et al. Value of serum cytokine biomarkers TNF-α, IL-4, sIL-2R and IFN-γ for use in monitoring bacterial load and anti-tuberculosis treatment progress. Cytokine X 2000;2:100028.  Back to cited text no. 18
    
19.
Butov DO, Kuzhko MM, Makeeva NI, Butova TS, Stepanenko HL, Dudnyk AB. Association of interleukins genes polymorphisms with multi-drug resistant tuberculosis in Ukrainian population. Pneumonol Alergol Pol 2016;84:168-73.  Back to cited text no. 19
    
20.
Abhimanyu, Bose M, Varma-Basil M, Jain A, Sethi T, Tiwari PK, et al. Establishment of elevated serum levels of IL-10, IL-8 and TNF-β as potential peripheral blood biomarkers in tubercular lymphadenitis: A prospective observational cohort study. PLoS One 2016;11:e0145576.  Back to cited text no. 20
    
21.
Xu L, Cui G, Jia H, Zhu Y, Ding Y, Chen J, et al. Decreased IL-17 during treatment of sputum smear-positive pulmonary tuberculosis due to increased regulatory T cells and IL-10. J Transl Med 2016;14:179.  Back to cited text no. 21
    
22.
Xu H, Jia Y, Li Y, Wei C, Wang W, Guo R, et al. IL-10 Dampens the Th1 and Tc Activation through Modulating DC Functions in BCG Vaccination. Mediators Inflamm 2019;2019:8616154.  Back to cited text no. 22
    
23.
Shekar-Abi M, Miandehi N, Mansoori SD, Tavasoli Fayri M, Alibahar M, Amirkhani A, et al. The study of Th1/Th2 cytokine profiles (IL-10, IL-12, IL-4, and IFNγ) in PBMCs of patients with multidrug resistant tuberculosis and newly diagnosed drug responsive cases. TANAFFOS (Respiration) 2004;3:25-31.  Back to cited text no. 23
    
24.
Mootoo A, Stylianou E, Arias MA, Reljic R. TNF-alpha in tuberculosis: A cytokine with a split personality. Inflamm Allergy Drug Targets 2009;8:53-62.  Back to cited text no. 24
    
25.
Zhang Z, Fan W, Yang G, Xu Z, Wang J, Cheng Q, et al. Risk of tuberculosis in patients treated with TNF-α antagonists: A systematic review and meta-analysis of randomised controlled trials. BMJ Open 2017;7:e012567.  Back to cited text no. 25
    
26.
Damayanti N, Yudhawati R. The comparison of pleural fluid TNF-α levels in tuberculous and nontuberculous pleural effusion. Indian J Tuberc 2020;67:98-104.  Back to cited text no. 26
    
27.
Yamada G, Shijubo N, Shigehara K, Okamura H, Kurimoto M, Abe S. Increased levels of circulating interleukin-18 in patients with advanced tuberculosis. Am J Respir Crit Care Med 2000;161:1786-9.  Back to cited text no. 27
    
28.
Bentwich Z, Kalinkovich A, Weisman Z, Borkow G, Beyers N, Beyers AD. Can eradication of helminthic infections change the face of AIDS and tuberculosis? Immunol Today 1999;20:485-7.  Back to cited text no. 28
    
29.
Ali AH, Omer AA, Saeed NS, Mansour EE, Elhassan MM. Influence of interferon-gamma Receptor 1 gene polymorphisms on the susceptibility to pulmonary tuberculosis among sudanese population. Int J Mycobacteriol 2018;7:26-31.  Back to cited text no. 29
[PUBMED]  [Full text]  
30.
Masood KI, Irfan M, Masood Q, Jamil B, Rao S, Rahim M, et al. Increased Mycobacterium tuberculosis antigen-induced gene expression of interferon-gamma, tumor necrosis factor alpha and interleukin-6 in patients with diabetes. Int J Mycobacteriol 2016;5 Suppl 1:S246.  Back to cited text no. 30
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Methods
Results
Discussion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed396    
    Printed20    
    Emailed0    
    PDF Downloaded36    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]