• Users Online: 6454
  • Home
  • Print this page
  • Email this page


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2022  |  Volume : 11  |  Issue : 1  |  Page : 88-94

Spoligotyping and polymerase chain reaction based mycobacterium bovis strains typing with methods (enterobacterial repetitive intergenic consensus-polymerase chain reaction, randomly amplified polymorphic dnas-polymerase chain reaction and out polymerase chain reaction)


1 Department of Medical Microbiology, Faculty of Medicine, Adiyaman University, Adiyaman, Turkey
2 Tropical Diseases Research and Application Centeri, Çukurova University, Adana, Turkey

Date of Submission24-Dec-2021
Date of Decision11-Jan-2022
Date of Acceptance12-Feb-2022
Date of Web Publication12-Mar-2022

Correspondence Address:
Gülnur Tarhan
Department of Medical Microbiology, Faculty of Medicine, Adiyaman University, Adiyaman
Turkey
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmy.ijmy_253_21

Rights and Permissions
  Abstract 


Background: In this study, it was aimed to investigate Mycobacterium bovis strains isolated from lungs and lymph nodes of slaughtered animals on clonal level by using different methods such as spoligotyping, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR), randomly amplified polymorphic DNAs (RAPD-PCR) and OUT-PCR. Comparative evaluation of these methods was further conducted. Methods: A total of 38 M. bovis isolates were evaluated in the study. DNA isolation of all M. bovis strains isolated from pruvat free Löwenstein Jensen medium was done by boiling method for ERIC-PCR, RAPD-PCR, and OUT PCR. Mickle device was used for DNA isolation for spoligotyping method. Results: In 38 M. bovis isolates examined in our study, 4 different groups were determined by spoligotyping and RAPD-PCR test methods, and 5 different groups were detected in ERIC-PCR tests. In the OUT-PCR tests, the band which provides sufficient type separation was not observed. Conclusion: ERIC-PCR, RAPD-PCR, and OUT-PCR methods are easily applicable, simple, and relatively inexpensive methods for evaluating the differences between origins in the typing of M. bovis. The tests need to be evaluated in more detail with extensive studies.

Keywords: Enterobacterial repetitive intergenic consensus polymerase chain reaction, Mycobacterium bovis, OUT-polymerase chain reaction, randomly amplified polymorphic DNAs-polymerase chain reaction, Spoligotyping


How to cite this article:
Sahin F, Tarhan G, Cinoglu H, Kayar MB, Yakici G. Spoligotyping and polymerase chain reaction based mycobacterium bovis strains typing with methods (enterobacterial repetitive intergenic consensus-polymerase chain reaction, randomly amplified polymorphic dnas-polymerase chain reaction and out polymerase chain reaction). Int J Mycobacteriol 2022;11:88-94

How to cite this URL:
Sahin F, Tarhan G, Cinoglu H, Kayar MB, Yakici G. Spoligotyping and polymerase chain reaction based mycobacterium bovis strains typing with methods (enterobacterial repetitive intergenic consensus-polymerase chain reaction, randomly amplified polymorphic dnas-polymerase chain reaction and out polymerase chain reaction). Int J Mycobacteriol [serial online] 2022 [cited 2022 May 21];11:88-94. Available from: https://www.ijmyco.org/text.asp?2022/11/1/88/339517




  Introduction Top


Mycobacterium bovis which causes an infectious disease in humans and animals is included in the  Mycobacterium tuberculosis Scientific Name Search mplex (MTBC).[1] Microorganisms in this complex have been grouped according to their bacteriological characteristics and DNA similarity.[2] The genome sequence of M. bovis is highly similar to that of Mycobacterium tuberculosis. However, deletions in the genome of M. bovis caused shortenings in the genome length of the microorganism.[3] M. bovis is the species with the largest host distribution in MTBC. All of the microorganisms in this group cause tuberculosis (TB), chronic granulomatous disease in mammals and humans.[4]

Diagnosis of the disease is based on clinical findings in animals, regardless of laboratory findings. The diagnosis of bovine TB which is characterized by the formation of nodule granules is usually made by delayed-type hypersensitivity reaction in animals.[5] The increase in M. bovis infected strains in our country and the world has increased the work towards the spread and control of TB.[6] Controlling a pathogen in a system where it can infect more than one species is important in determining the role of each host species in infection Dynamics.[7]

Therefore, spoligotyping, MIRU-VNRT, and IS6110-RFLP methods based on the determination of repeater DNA elements are standard methods used especially in wide-ranging studies. Among these methods, spoligotyping is a widely used polymerase chain reaction (PCR)-based reverse dot blot hybridization method and is a fast, simple, repeatable method. MTBC genome contains different numbers of 36 bp DR locus. The DR locus has spacer sequences that form 35 to 41 base pairs in length between them. The method is based on the polymorphism of the DR locus [Figure 1]. The presence of spacer sequences and the number of copies of DRs varies between strains. One of the most important advantages of this method is that it can distinguish and type M. bovis.[8],[9]
Figure 1: (A) Schematic presentation of the polymorphism in DR regions of different M. tuberculosis complex strains. Blocks of DVR are missing in one strain when compaired to another. The spacer order remains about the same. (B) Principle of the in vitro amplification of DNA within the DR region of M. tuberculosis complex bacteria. The use of the 2 primers, a and b, for in vitro amplification, will lead to the amplification of any spacer or a stretch of neighbouring spacers and DR's. (C) Spoligotyping result of M. tuberculosis H37Rv, M. bovis BCG P3 and 38 different clinical isolates. A membrane with 43 spacer oligonucleotides was used (vertical lines). The spacer oligonucleotides were derived from the spacers of M. bovis V BCG P3, M. tuberculosis H37Rv.

Click here to view


Recently developed molecular methods have; provided the opportunity to evaluate the genoypic differences and similarities between bacterial origins of the same species. These methods are widely used in determining the source of transmission in infection control, characteristic properties of transmission sources, understanding the relationship between different outbreaks, understanding laboratory-induced cross-contamination, determination of regional genotypes emergence of disease forms, detection of antimicobacterial sensitivity patterns against major and minor agents.[10],[11] Enterobacterial Repetitive Intergenic Consensus Element (ERIC) is well squared in Gram-negative bacillus belonging to the Enterobacteriaceae family and used to square the clonal difference in the types of this family. The presence in mycobacteria of these sequences was also determined in several studies. It has been reported that ERIC-PCR is fast and easy to use in epidemiological studies.[8],[12]

Randomly Amplified Polymorphic DNAs (RAPD) allows a large number of samples to work using randomly designed oligonucleotide chains without the need for information about the genome.[13]

This study aimed to investigate, the relationship between M. bovis strains isolated from TB granulomas of animals slaughtered in a private slaughterhouse. Comparative evaluations of different methods, i.e., spoligotyping, ERIC-PCR, RAPD-PCR, and OUT-PCR were also conducted.


  Methods Top


Ethics statement

Our study was derived from M. bovis strains isolated in our laboratory and does not require an ethics committee decision.

Bacteria isolates

Thirty-eight M. bovis strains isolated from cattle carcasses with a typical granulomatous lesion detected during the inspection of the Provincial Directorate of Agriculture between October 2017 and January 2018 in a private slaughterhouse were evaluated. M. bovis identification of isolates produced on Lowenstein–Jensen (LJ) medium with 0.4% pyruvate without glycerol was performed by in house PCR method using M. bovis specific gene regions (Fo1; 5'CGTGAGGGCATCGAGGTGGC3' ve IS6110 Rev2; 5'CCTGCGAGCGTAGGCGTCGG 3).[14]

DNA Isolation

A loopful of colonies grown in culture was removed and suspended in 500 μl TE buffer (10 mM Tris, 1 mM Ethylenediaminetetraacetic acid, pH 8.0). After centrifuging at 15,000 × g for 10 min, the supernatant was discarded. The same process was applied to the precipitate a second time. After the supernatant was discarded, the precipitate was suspended in 250 μl distilled water and left in a boiling water bath for 20 min. After centrifugation, the supernatant containing DNA was transferred to sterile microcentrifuge tubes. It was kept at-40°C until the test period.[15]

Enterobacterial repetitive intergenic consensus polymerase chain reaction

For this test, 5 'ATG TAA GCT CCT GGG GAT TCA C 3' and 5 'AAG TAA GTG ACT GGG GTG AGC G 3' primers were used. The composition of the PCR mixture (50 μl) was 29,9 μl dH2O, 5 μl 10XBuffer (Mg2+ free, Biomatik 1.25 Ml), 3 μl MgCl2 (Biomatik 25 mM), 1 μl dNTP Mix (Blirt 2 mM), 0,5 μl ERIC1R (87 pmol/μl) and ERIC2 (73 pmol/μl), 0,1 μl Taq Polymerase (Biomatik 5U/μl) and 10 μl template DNA for each tube.[16] The PCR reaction was performed to 60 cycles of amplification (94°C for 2 min, 94°C for 45 sec, 52°C for 1 min) and 72°C for 12 min. This was followed by final extension. The presence of an amplified product was confirmed by polyacriylamide gel electrophoresis.

Randomly amplified polymorphic DNAs-polymerase chain reaction

Fort this test, A: 5'CTCACGTTGG 3' (Macrogen 34 nmol), B: 5' ACCAGGGGCA 3' (Macrogen 34 nmol), C: 5' ACTGAACGCC 3' (Macrogen 34 nmol), D: 5'TGCCGGCTTG 3'(Macrogen 34 nmol), E: 5' GGTGCTCCGT 3' (Macrogen 34 nmol), F: 5' CTCGAGCGGC 3' (Macrogen 34 nmol), G: 5' CGACGCTGCG 3' (Macrogen 34 nmol) primers were used The composition of the PCR mixture (50 μl) was 27.4 μl dH2O, 5 μl 10XBuffer (1,25 Ml Mg2+ free, Biomatik), 3 μl MgCl2 (Biomatik, 25 mM), 1 μl dNTP Mix (Blirt, 2 mM), 0,5 μl Primers, 0.1 μl Taq Polimeraz (Biomatik 5U/μl) and 10 μl template DNA for each tube.[17] The PCR reaction was subjected to 35 cycles of amplification 94°C for 2 min, 94°C for 45 sec, 52°C for 1 min. This was followed by 12 min of extension at 72°C. The presence of amplified product was confirmed by 1.4% NuiSieve agarose gel (Sigma, St Louis, MO, USA).[8]

OUT-polymerase chain reaction

Only GAC III 5' CCG GGG CGG TTC A 3' (Macrogen 250 nmol) primer was used. The reaction mixture was prepared as 30.4 μl dH2O, 5 μl 10 × Buffer (1,25 Ml Mg2+ free, Biomatik), 3 μl MgCl2 (Biomatik, 25 mM), 1 μl dNTP Mix (Blirt, 2 mM), 0,5 μl Primers, 0.1 μl Taq Polimeraz (Biomatik, 54 μl) and 10 μl template DNA for each tube The PCR reaction was subjected to 35 cycles of amplification 94°C for 2 min, 94°C for 45 sec, 60°C for 1 min. This was followed by 12 min of extension at 72°C. The presence of amplified product was confirmed by 1.4% NuiSieve agarose gel (Sigma, St Louis, MO, USA).[8]

Spoligotyping

This test was studied in the Microbiology Laboratory of the Cukurova University Tropical Diseases Research and Application Center. After sub-LJ culture medium of the isolates, DNA isolation were performed by using Mickle (Mickle tissue will disintegrate) device. DRa 5'-GGT TTT GGG TCT GAC GAC-3' ve DRb 5'-CCG AGA GGG GAC GGA AAC-3' primers were used for amplification.[18] The reaction mixture was prepared as 9,5 μl dH2O, 3,5 μl 2XBuffer (Fermentas, 1,5 mM MgCl2 free), 4 μl MgCl2 (Fermentas, 4 mM), 0,25 μl dNTP Mix (Fermentas, 1,6 mM), 0,25 μl DRa (25 pmol/μl), 0,25 μl DRb (25 pmol/μl) and 2,50 μl template DNA for each tube. The PCR reaction was performed to 60 cycles of amplification (95°C for 5 min, 94°C for 1 min, 55°C for 1 min, 72°C for 45 s), and 72°C for 10 min. This is followed by final extension. After the reaction was completed, amplicons were kept at +4°C until the working day. Results were converted to the octal code format of the 15 octal code from 0 to 7. The data obtained were evaluated by comparing them with the registered strains in the spoligotyping database of Mbovis.org at https://www.mbovis.org/.[16],[17],[18],[19],[20],[21] All spoligotyping results are indicate in [Table 1] and [Table 2] and [Figure 1].
Table 1: Spoligotyping patterns of Mycobacterium bovis isolate

Click here to view
Table 2: Spoligotyping patterns of Mycobacterium bovis isolate

Click here to view



  Results Top


In our study, 38 M. bovis clinical isolates collected from cattle carcasses were evaluated. According to the results obtained from the spoligotyping test; it was determined that the isolates clustered in 4 different spoligotype families as SB1196, SB2513, SB1197, and SB2508. SB1196 (31.6%) were found to be the most common profile in the studied sample group. Spoligotype families determined according to sample groups in the study are given in [Table 1] and [Table 2]. The dendograms of all groups are shown in [Figure 2].
Figure 2: Dendogram of spoligotyping results of compared samples from M.bovis.org according to SB groups.

Click here to view


According to the results of ERIC-PCR test, 5 groups were determined considering all isolates [Figure 3]. When all samples were evaluated together, a clear band image could not be obtained in some sample groups. In the evaluation performed with the RAPD-PCR test, 4 groups were determined [Figure 4]. While 4 groups were detected in the evaluation performed with the RAPD-PCR test, no band fragments that would provide definite group distinction with the OUT-PCR method were observed [Figure 5]. When the spoligotyping method is considered the gold standard, the matching ratio of the samples in the same group according to the methods is given in [Table 3].
Figure 3: ERIC-PCR gel image

Click here to view
Figure 4: RAPD-PCR gel image

Click here to view
Figure 5: OUT-PCR gel image

Click here to view
Table 3: Matching of spoligotyping method according to enterobacterial repetitive intergenic consensus-polymerase chain reaction and randomly amplified polymorphic DNAs-polymerase chain reaction methods

Click here to view



  Discussion Top


Recently, there are hypotheses that humans may have reservoirs in the transportation of bovine TB.[18] Practical, inexpensive, and highly reproducible tests are required to identify the sources of infection in infection control and epidemic situations.[11],[16],[19] In recent studies, in-house PCR methods such as RAPD-PCR, ERIC-PCR and OUT-PCR have been used to determine the relationship between bacterial origins in cross-contamination and epidemiological studies.[17]

In our study, in the evaluation made by spoligotyping method with 38 M. bovis strains isolated from cattle carcasses, 4 different groups were identified. Yardimci et al. identified three different spoligo subtypes on 72 tissue samples from 36 cattle collected from slaughterhouses in Ankara in their study. In that study, M. bovis AN/5 strain was used as a control strain and Spb7 (45%), Spb8 (10%), and Spb13 (45%) subspecies were determined. However, no information was provided about the origins of the strains.[20] Aranaz et al. found that 30 of 182 M. bovis isolates collected from 27 farms and different animals were belonged to cattle.[8] As a result of spoligotyping of the isolates detected in cattle, 9 subtypes were identified. The Spb-7 (30%) was determined as a common subtype. It has been stated that the results obtained from the study are similar to the regional epidemiological data.[8] ERIC-PCR has mostly been used for identifying Gram-negative bacteria. The first study in MTBC genomes was published by Sechi et al. In that study, 59 different profiles were detected in 71 clinical samples collected over 4 years. When the obtained profiles were compared with IS6110, it was found that the similarity rate and the sensitivity of ERIC-PCR were high on mycobacteria.[19] Khosravi et al. determined 3 groups according to RAPD-PCR results on mycobacteria and 6 groups according to ERIC-PCR results. They reported that ERIC-PCR has a better discrimination power in PCR combination, and typing gives succesful results in the first step in genotype diversity and infection control. At the same time, having simple and repeatable methods is suggested as an advantageous by other researchers in standardization of PCR conditions.[11],[21]

Caleffi-Ferracioli et al. detected M. bovis strains in 17 samples in their study on 176 MTBC clinical isolates in 2 different centers and found that these isolates were divided into 5 different spoligo subgroups.[12] Carneiro et al. identified 6 subspecies of 35 M. bovis isolate that they isolated from cattle in Brazil, i.e., SB0822, SB0295, SB1869, SB0121, SB1800, SB1608. Although SB0822 is the most common isolate in the region, they found SB1869 (17%) as the most common isolate in their study.[12] In an original study, M. tuberculosis isolates showed a 100% compatible result compared to OUT-PCR and spoligotyping method.[17] Thus wide-ranging studies of the method are needed.

In our study, the spoligotyping method was taken as the gold standard. The grouping proportion of the matched strains in four groups in ERIC-PCR is 58.3%, 45.5%, 57.1%, and 50.0%. For RAPD-PCR, those rates were 25.0%, 36.4%, 28.6% and 37.5% for four groups, respectively.

In conclusion, molecular methods have proven useful for detecting and controling many outbreaks of infection caused by bacteria. Determining the M. bovis strains isolated from human and animal TB cases will ensure the control of TB cases whose source is animal and animal products. PCR-based methods appear as practical, inexpensive, and easy methods in studies when good standardization of identicals with the priority is made. Wide-range comprehensive studies are needed for routine usage.

Limitation of study

Standardization of the method with more samples for use in the routine. In our study, the absence of DNA sequencing of the strains.

Ethical clearance

Our study was derived from M. bovis strains isolated in our laboratory and does not require an ethics committee decision.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Kanipe C. and M.V. Palmer, Mycobacterium bovis and you: A comprehensive look at the bacteria, its similarities to Mycobacterium tuberculosis, and its relationship with human disease. Tuberculosis 2020;125:102006.  Back to cited text no. 1
    
2.
Hussain T, Leprosy and tuberculosis: An insight-review. Critical reviews in microbiology 2007; 33:15-66.  Back to cited text no. 2
    
3.
Wahdan A, Riad E.M, Enany S. Genetic differentiation of Mycobacterium bovis and Mycobacterium tuberculosis isolated from cattle and human sources in, Egypt (Suez Canal area). Comparative Immunology, Microbiology and Infectious Diseases, 2020;73:101553.  Back to cited text no. 3
    
4.
Romha G, et al. Epidemiology of Mycobacterium bovis and Mycobacterium tuberculosis in animals: Transmission dynamics and control challenges of zoonotic TB in Ethiopia. Preventive Veterinary Medicine 2018;158:1-17.  Back to cited text no. 4
    
5.
Benedictus L, et al. Hydrophobic Mycobacterial Antigens Elicit Polyfunctional T Cells in Mycobacterium bovis Immunized Cattle: Association With Protection Against Challenge? Frontiers in immunology 2020;11:588180.  Back to cited text no. 5
    
6.
Otchere I.D, et al. Molecular epidemiology and whole genome sequencing analysis of clinical Mycobacterium bovis from Ghana. PloS one 2019;14: e0209395.  Back to cited text no. 6
    
7.
Marianelli C, et al. Genotype diversity and distribution of Mycobacterium bovis from livestock in a small, high-risk area in northeastern Sicily, Italy. PLoS neglected tropical diseases 2019;13:e0007546.  Back to cited text no. 7
    
8.
Aranaz A, et al. Spacer oligonucleotide typing of Mycobacterium bovis strains from cattle and other animals: A tool for studying epidemiology of tuberculosis. J Clin Microbiol 1996;34:2734-40.  Back to cited text no. 8
    
9.
Carneiro P.A, et al. Molecular characterization of Mycobacterium bovis infection in cattle and buffalo in Amazon Region, Brazil. Veterinary medicine and science, 2020;6:133-141.  Back to cited text no. 9
    
10.
Coll P. and D.G. de Viedma, Molecular epidemiology of tuberculosis. Enfermedades infecciosas y microbiologia clinica (English ed.), 2018. 36(4): p. 233-240.  Back to cited text no. 10
    
11.
Ramos, D.F, et al. Molecular typing of Mycobacterium bovis isolates: A review. Brazilian Journal of Microbiology, 2014;45:365-72.  Back to cited text no. 11
    
12.
Caleffi-Ferracioli K.R, et al. Molecular characterization of Mycobacterium tuberculosis and Mycobacterium bovis isolates by Enterobacterial Repetitive Intergenic Consensus-PCR. Brazilian Journal of Pharmaceutical Sciences;2018;54.  Back to cited text no. 12
    
13.
Ghavidel M, et al, The most common spoligotype of Mycobacterium bovis isolated in the world and the recommended loci for VNTR typing; A systematic review. Microbial Pathogenesis 2018;118:310-15.  Back to cited text no. 13
    
14.
Kuria J, Akwalu S, Muema L. The etiology and public health significance of mycobacteriosis of cattle in Kenya. International Journal of Mycobacteriology, 2018;7:251-6.  Back to cited text no. 14
    
15.
Ergin, A., T. Kocagöz, and D. Us, Evaluation of 120 mycobacterial strains isolated from clinical specimens to the species level by polymerase chain reaction-restriction enzyme analysis. Scandinavian journal of infectious diseases 2000;32:657-62.  Back to cited text no. 15
    
16.
Sampaio J, et al. Application of four molecular typing methods for analysis of Mycobacterium fortuitum group strains causing post-mammaplasty infections. Clinical Microbiology and Infection 2006;12:142-9.  Back to cited text no. 16
    
17.
Tarhan G, Ocak F, Ceyhan I, Comparision of ERIC-PCR, OUT-PCR and Spoligotyping Methods to Diagnose of Cross-Contamination with Mycobacterium tuberculosis. World Health 2016;20:22.  Back to cited text no. 17
    
18.
Wei C.Y, et al. Molecular and histopathologic evidence for systemic infection by Mycobacterium bovis in a patient with tuberculous enteritis, peritonitis, and meningitis: A case report. The Kaohsiung journal of medical sciences, 2004. 20:302-7.  Back to cited text no. 18
    
19.
Yardımcı H, et al. Sığır tüberkülozunun PCR ile tanısı ve Mycobacterium bovis' in spoligotiplendirme yöntemi ile genotiplendirilmesi. Ankara Üniversitesi Veteriner Fakültesi Dergisi 2007;54:183-9.  Back to cited text no. 19
    
20.
Sechi L.A, et al. Enterobacterial repetitive intergenic consensus sequences as molecular targets for typing of Mycobacterium tuberculosis strains. Journal of clinical microbiology 1998;36:128-32.  Back to cited text no. 20
    
21.
Khosravi A.D, et al. Molecular identification of clinical isolates of mycobacterium fortuitum by Random Amplified Polymorphic DNA (RAPD) polymerase chain reaction and ERIC PCR. Journal of clinical and diagnostic research: JCDR 2015;9:DC01.  Back to cited text no. 21
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Methods
Results
Discussion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed402    
    Printed16    
    Emailed0    
    PDF Downloaded33    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]