The International Journal of Mycobacteriology

ORIGINAL ARTICLE
Year
: 2022  |  Volume : 11  |  Issue : 3  |  Page : 318--322

Correlation of single-nucleotide polymorphism at interferon-gamma R1 (at Position − 56) in positive purified protein derivative health workers with COVID-19 infection


Mohammad Varahram1, Saeid Besharati1, Poopak Farnia2, Jalaledin Ghanavi1, Shima Saif1, Jalal Heshmat Nia3, Mohammad Reza Madani3, Parissa Farnia1, Ali Akbar Velayati1,  
1 Mycobacteriology Research Center, National Research Institute of Tuberculosis and Lung Disease, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2 Department of Biotechnology, School of Advanced Technology in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
3 Chronic Respiratory Diseases Research Center, National Research Institute of Tuberculosis and Lung Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Correspondence Address:
Saeid Besharati
Mycobacteriology Research Center, National Research Institute of Tuberculosis and Lung Disease, Shahid Beheshti University of Medical Sciences, Tehran
Iran

Abstract

Background: The aim of the present study was to investigate the susceptibility of purified protein derivative (PPD) plus health-care workers to SARS-CoV-2 (COVID-19). For this reason, single-nucleotide polymorphism (SNP) of interferon-gamma (IFN-γ) gene at position +2109 and IFN-γ receptor 1 (R1) at position −56 was assessed in PPD plus group before and after COVID-19 infection (2017–2018; 2020–2021). Methods: The selected study cases (n = 100) that were working in tuberculosis (TB) unite (5–10 years) with PPD positivity >15 mm (16–20 mm) were included in this investigation. Sampling was done twice, once before and after the COVID-19 pandemic. Group A contains 50 samples collected from the GenBank TB laboratory that belong to TB staff before the pandemic (2017–2018). The other sample (Group B; 2021) was collected from the same unite during the COVID-19 pandemic. The SNP in the IFN-γ gene (+2109; 670 bp) and IFN-γ R 1 (−56; 366 bp) was performed using a specific primer and the polymerase chain reaction products were digested using restriction enzyme Fau I and Bts I, respectively. Statistical analyses were used to obtain the frequency of alleles among all studied cases. The confidence intervals (CIs) and t-test were calculated using the SPSS and GraphPad Prism software. Results: In overall, the most frequent genotype in Group A was AA (41/50; 82%) and Group B was 76% (38/50) in position + 2109 (odds ratio [OR] = 0.69, 95% CI, 0.26–1.83, and P = 0.46). Although in position −56, the most frequent genotype in Group A was TT (35/50; 70%) which significantly was than Group B TT (15/50; 30%) (OR = 0.184, 95% CI, 0.78–0.43, and P = 0.00). The frequency of allele A was more in both groups at position + 2109 (OR = 0.815, 95% CI, 0.23–2.86, and P = 0.75), whereas the dominate allele at position −56 was T in Group A (OR = 1.37, 95% CI, 0.62–3.02, and P = 0.42). Conclusion: No significant differences were observed in + 2109 in genotype among Group A and B. The main differences were seen in IFN-γ R1 at position (−56) between Group A and B. Hence, the IFN-γ R1 may play important role in COVID-19 infection. However, more study is needed to clear the IFN-γ correlation to COVID-19 infection.



How to cite this article:
Varahram M, Besharati S, Farnia P, Ghanavi J, Saif S, Nia JH, Madani MR, Farnia P, Velayati AA. Correlation of single-nucleotide polymorphism at interferon-gamma R1 (at Position − 56) in positive purified protein derivative health workers with COVID-19 infection.Int J Mycobacteriol 2022;11:318-322


How to cite this URL:
Varahram M, Besharati S, Farnia P, Ghanavi J, Saif S, Nia JH, Madani MR, Farnia P, Velayati AA. Correlation of single-nucleotide polymorphism at interferon-gamma R1 (at Position − 56) in positive purified protein derivative health workers with COVID-19 infection. Int J Mycobacteriol [serial online] 2022 [cited 2022 Nov 26 ];11:318-322
Available from: https://www.ijmyco.org/text.asp?2022/11/3/318/355921


Full Text



 Introduction



Purified protein derivative (PPD) which is called PPD is one of the most common tests to check tuberculosis (TB) that are injected intravenously (five unite) and evaluated after 48–72 h.[1],[2] The positive PPD test (≥10 mm), means the individual is infected with Mycobacterium. The advantages of PPD test include low cost and easy to perform, and their disadvantages include the need for follow-up and trained people to interpret it. Reported false-positive occurred due to cross-reactivity of PPD antigen with vaccinated people with Bacillus Calmette-Guerin (BCG) or infection with nontuberculous mycobacteria. A ≥10 mm reaction can be considered positive for latent TB infection in the endemic region, especially in TB medical staff whom are at risk of occupied exposure to TB.[2],[3],[4],[5],[6] For the past 2 years, the world was occupied with a new pandemic named SARS-CoV-2 (COVID-19). After several months of investigation, this pandemic remained the main obscure issue of public health problems, especially with the newly mutated forms of the virus.[7],[8],[9],[10] Therefore, one of the main questions raised was about an understanding of the relation between viruses and the host immune system. Most of the review literature showed interferon-gamma (IFN-γ) gene plays an important role in the control of intracellular pathogens such as leishmaniasis and TB.[9],[11],[12] Since mutation in the IFN-γ gene in host cells shows susceptibility to many intracellular pathogens, we thought this might be an impatient factor(s) to study among COVID-19-infected cases who had also PPD positivity. Previously, we showed the susceptibility of leprosy and TB patients at the +2109 IFN-γ gene and −56 receptor IFN-γ. Hence, we tried to investigate the correlation between PPD positivity workers (latent TB) with COVID-19 infection. For this reason, the IFN-γ gene and receptor were compared and analyzed between two groups of patients who had PPD positive with and without COVID-19 infection and the others who had an infection. The studied cases were selected from those person that had been working as nurses or TB laboratory staff for 5–10 years with PPD >15 mm.[13],[14],[15],[16]

 Methods



Patient data

The studied cases divide into Group A and B: group A was PPD plus without COVID-19 infection and Group B was PPD plus with COVID-19; the patient's age and gender were most similar. The patients with COVID-19 were confirmed with a specific primer S gene: forward: GCTGGTGCTGCAGCTTATTA; reverse: AGGGTCAAGTGCACAGTCTA), using real-time technique.[17] They had no underline diseases, such as diabetes, cancer, and high blood pressure. All of the cases are working as nurses or TB laboratory staff (between 5 and 10 years) in the National Research Institute of TB and Lung Diseases (NRITLDs). Sampling in Group A carried out as a routine checkup test in 2017–2018 and Group B in 2020–2021 during the pandemic.

Ethical statement

This study was approved by the Ethical Committee of NRITLD, Shahid Beheshti University of Medical Sciences (IR.SBMU.NRITLD.REC.1399.201).

Genotyping

DNA isolation and extraction

A briefly equal amount of phosphate-buffered saline (×1) was mixed with 3 ml of blood. After cool centrifugation (4°C), at 4500 rpm for 10 min, the white blood cells were separated and transferred into small microtubes. Then, 500 μl SE buffer (EDTA [0.5M] + NaCl [3M]) and 15 μl proteinase K (20 mg/ml) were added and kept at 37°C incubator up to 24 h. Finally, the phenol–chloroform method was used for DNA extraction.[18],[19] The extracted DNA was visualized on electrophoresis using 0.8% agarose gel.

Single-nucleotide polymorphism and polymerase chain reaction-restriction fragment length polymorphism

IFN-γ gene +2109 and IFN-γ-R1 −56 polymorphisms were detected using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP). PCR was performed to analyze mutant and nonmutant in blood samples of Group A and B. The primer used in this study is shown in [Table 1]. To detect mutation, each PCR product was digested using Fau I (+2109) and bts I (−56) restriction enzyme. PCR-RFLP product for IFN-γ gene +2109 produces three kinds of polymorphism; AA, AG, and GG, and the IFN-γ-R1 at position −56 produce three patterns TT, TC, and CC. All the digested PCR products were electrophoresed on 3% agarose gel [Figure 1] and [Figure 2].{Figure 1}{Figure 2}{Table 1}

Statistical analysis

The gene counting method was used to obtain the frequency of alleles among all participants and relative risk for the disease was calculated by odds ratios (ORs), 95% confidence intervals (CIs), and t-test. Chi-square test was used to evaluate the probability of a significant polymorphic allele or genotype between case and control groups. P < 0.05 values were considered significant in all analyzes. The SPSS software version 22 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism software version 8.02 (GraphPad Software Inc., San Diego, CA, USA) were used to analyze the data.

 Results



The amplified PCR products for IFN-γ +2109 and IFN-γR1 −56 were 670 bp and 366 bp, respectively. After confirmation of PCR products, digestion was performed with restriction enzymes Fau1 (+2109) and Bts1, (−56) by PCR-RFLP method. For IFN-γ +2109, PCR digested produced three types of pattern (unmutated homozygous AA, 366 bp; mutant heterozygous AG 366–269–97 bp; mutant homozygous GG 269–97 bp). For IFN-γ−56, PCR digested produced three types of pattern (unmutated homozygous TT, 313–215-142 bp; mutant heterozygous TC, 455–313-215–142 bp; mutant homozygous CC 455–313-215 bp).

Genotype of interferon-gamma-γ +2109

The frequency of genotype AA (in both groups) at the polymorphic site was 82% (41/50) and 76% (38/50), respectively. Hence, no statically significant difference was observed at the polymorphic site (+2109) between the two groups. Although the frequency of genotype AG in Group B (heterozygous mutant) showed a slight increase, it was not statistically significant [Table 2]. In coverall, the comparison of allele AG showed that allele A was 90% (45/50) in Group A and 88% (44/50) in Group B [Table 3].{Table 2}{Table 3}

Genotype of I interferon-gamma-γ-R1 − 56

As previously shown in the method section, digestion of −56 also produces three types of genotype TT, TC, and, CC. The result showed a significant increase in TT genotype (unmutated) in Group A (PPD + without COVID-19 infection) in comparison to Group B (PPD + with COVID-19 infection). Whereas in Group B (PPD + with COVID-19 infection), the mutated genotype TC 48% (24/50) and CC genotype 22% (11/50) were more significant (P = 0.041, OR: 2.37, 95% CI: 1.03–5.44) and (P = 0.014, OR: 13.82, 95% CI: 1.71–111.72), respectively [Table 3]. The most frequent allele IFN-γ +2109 was A (45/50, 90%) in comparison to allele G (5/50, 10%) in the same group. The same frequency (44/50, 88%, and 6/50, 12%) was observed in Group B. It means the allele A is dominant in Groups A and B. In total frequency of allele C was significant in Group A (23/50, 46%) than in Group B (8/50, 16%) (P = 0.002, OR: 4.47, 95% CI: 1.74–11.43) [Table 3].

 Discussion



Interferon (like IFN-γ) plays a very important role in the body's defense against intracellular bacteria and viruses.[20],[21],[22] Our studies showed an association between single-nucleotide polymorphism (SNP) IFN-γ gene at position +2109 and IFN-γ R1 at position −56 in susceptibility to TB,[12],[14],[23],[24] rapid grower mycobacterium.[25] The other studies show a relation between IFN-γ and intracellular infections such as leishmaniasis[26] or hepatic schistosomiasis.[27] Although the information about the effect of the IFN-γ gene and receptor at the polymorphic site in COVID-19 infection has not been studied completely. In a cross-sectional study conducted by Tadolini, 49 patients were studied in 26 centers who had coinfection with active TB and COVID-19 that only two cases were of health-care workers in his study (medical doctor and radiology technician); therefore, the correlation between COVID-19 and activated tuberculosis needs more investigation.[28] In this study, we purposefully examined PPD + health-care workers that were treated as COVID-19 patients during the pandemic. We found no statistically significant difference in IFN-γ gene position at +2109 [Table 2]. Our result showed [Table 2] that most PPD + workers who did not get COVID-19 infection had unmutated IFN-γ R1 at position −56. Whereas the dose how infected with COVID-19 had eider mutation TC or CC at −56. This shows that SNP at position −56 of IFN-γ R1 might play important roles not only in intracellular bacteria but also in virus infection. In addition, we also isolated to the individual who got frequent (more than two) COVID-19 infections, even after the COVID-19 vaccination. Both these patients had homozygote mutation at −56 and +2109. This shows the indirect relationship between SNP of IFN-γ and COVID-19 infection which needs more investigation. Recently, Garg et al. reported reactivation of TB after COVID-19 infection.[29] At present, we are studying the correlation of transforming latent to active TB infection among COVID-19 cases. At this time, we could only show significant differences at the polymorphic site of −56 in COVID-19 infection. In cases that had positive PPD, in other words, the polymorphic gene (−56) was found in the latent patient. However, the numbered studies were low, we suggest more studies to perform on the underline signaling pathway in the IFN-γ gene and receptor in COVID-19 infection patients.

 Conclusion



Mutation at IFN-γ receptor position −56 shows susceptibility to COVID-19 infection. We suggest another polymorphic site to study the IFN-γ gene and receptor at the various polymorphic sites is needed.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

References

1Huebner RE, Schein MF, Bass JB Jr. The tuberculin skin test. Clin Infect Dis 1993;17:968-75.
2Lewinsohn DM, Leonard MK, LoBue PA, Cohn DL, Daley CL, Desmond E, et al. Official American Thoracic Society/Infectious Diseases Society of America/Centers for Disease Control and Prevention clinical practice guidelines: Diagnosis of tuberculosis in adults and children. Clin Infect Dis 2017;64:e1-33.
3Hashash JG, Abou Fadel C, Hosni M, Hassoun L, Kanafani Z, Regueiro MD. Approach to latent tuberculosis infection screening before biologic therapy in IBD patients: PPD or IGRA?. Inflammatory Bowel Diseases 2020;26:1315-8.
4Kruczak K, Mastalerz L, Sładek K. Interferon-gamma release assays and tuberculin skin testing for diagnosing latent Mycobacterium tuberculosis infection in at-risk groups in Poland. Int J Mycobacteriol 2016;5:27-33.
5Benachinmardi K, Sampath S, Rao M. Evaluation of a new interferon gamma release assay, in comparison to tuberculin skin tests and quantiferon tuberculosis goldplus for the detection of latent tuberculosis infection in children from a high tuberculosis burden setting. Int J Mycobacteriol 2021;10:142-8.
6Mirsaeidi M, Sadikot RT. Patients at high risk of tuberculosis recurrence. Int J Mycobacteriol 2018;7:1-6.
7Velayati A, Farnia P, Besharati S, Farnia P, Ghanavi J. The importance of genomic changes of SARS-CoV-2 and its comparison with Iranian-reported COVID-19 sequencing; Whether each country has to design its treatment and vaccine production. Biomedical and Biotechnology Research Journal 2020;4:13.
8Besharati S, Farnia P, Farnia P, Ghanavi J, Velayati A. Investigation of the hypothesis of biofilm formation in coronavirus (COVID-19). Biomedical and Biotechnology Research Journal 2020;4:99.
9Ghanavi J, Farnia P, Farnia P, Velayati AA. The role of interferon-gamma and interferon-gamma receptor in tuberculosis and nontuberculous mycobacterial infections. Int J Mycobacteriol 2021;10:349-57.
10Akter F, Tabassum S, Rahman A. Prevalence of severe acute respiratory syndrome coronavirus-2 among the young people and association between diabetes, hypertension, and severe acute respiratory syndrome coronavirus-2. Biomed Biotechnol Res J 2021;5:134.
11da Silva GA, Mesquita TG, Souza VC, Junior JD, Gomes de Souza ML, Talhari AC, et al. A single haplotype of IFNG correlating with low circulating levels of interferon-γ Is associated with susceptibility to cutaneous leishmaniasis caused by Leishmania guyanensis. Clin Infect Dis 2020;71:274-81.
12Shamsi M, Zolfaghari MR, Farnia P. Association of IFN-γ and P2X7 receptor gene polymorphisms in susceptibility to tuberculosis among Iranian patients. Acta Microbiol Immunol Hung 2016;63:93-101.
13Chong WP, Ip WK, Tso GH, Ng MW, Wong WH, Law HK, et al. The interferon gamma gene polymorphism+874 A/T is associated with severe acute respiratory syndrome. BMC Infect Dis 2006;6:82.
14Varahram M, Farnia P, Nasiri MJ, Karahrudi MA, Dizagie MK, Velayati AA. Association of Mycobacterium tuberculosis lineages with IFN-γ and TNF-α gene polymorphisms among pulmonary tuberculosis patient. Mediterr J Hematol Infect Dis 2014;6:e2014015.
15Henri S, Stefani F, Parzy D, Eboumbou C, Dessein A, Chevillard C. Description of three new polymorphisms in the intronic and 3'UTR regions of the human interferon gamma gene. Genes Immun 2002;3:1-4.
16Jamaati H, Fadaizadeh L, Khoundabi B, Hashemian SM, Monjazabi F, Jahangirifard A, et al. COVID-19-Related severe heterogeneous acute respiratory distress syndrome: A therapeutic challenge. Biomed Biotechnol Res J 2020;4:75.
17Park M, Won J, Choi BY, Lee CJ. Optimization of primer sets and detection protocols for SARS-CoV-2 of coronavirus disease 2019 (COVID-19) using PCR and real-time PCR. Exp Mol Med 2020;52:963-77.
18Lahiri DK, Bye S, Nurnberger JI Jr., Hodes ME, Crisp M. A non-organic and non-enzymatic extraction method gives higher yields of genomic DNA from whole-blood samples than do nine other methods tested. J Biochem Biophys Methods 1992;25:193-205.
19Angelini A, Di Febbo C, Rullo A, Di Ilio C, Cuccurullo F, Porreca E. New method for the extraction of DNA from white blood cells for the detection of common genetic variants associated with thrombophilia. Pathophysiol Haemost Thromb 2002;32:180-3.
20Billiau A, Matthys P. Interferon-gamma: A historical perspective. Cytokine Growth Factor Rev 2009;20:97-113.
21Sasaki Y, Nomura A, Kusuhara K, Takada H, Ahmed S, Obinata K, et al. Genetic basis of patients with bacille Calmette-Guérin osteomyelitis in Japan: Identification of dominant partial interferon-gamma receptor 1 deficiency as a predominant type. J Infect Dis 2002;185:706-9.
22Chesler DA, Reiss CS. The role of IFN-gamma in immune responses to viral infections of the central nervous system. Cytokine Growth Factor Rev 2002;13:441-54.
23Velayati AA, Farnia P, Khalizadeh S, Farahbod AM, Hasanzadh M, Sheikolslam MF. Interferon-gamma receptor-1 gene promoter polymorphisms and susceptibility to leprosy in children of a single family. Am J Trop Med Hyg 2011;84:627-9.
24Farnia P, Ghanavi J, Saif S, Farnia P, Velayati AA. Association of interferon-γ Receptor-1 gene polymorphism with nontuberculous mycobacterial lung infection among Iranian patients with pulmonary disease. Am J Trop Med Hyg 2017;97:57-61.
25Farnia P, Ghanavi J, Tabasri P, Saif S, Velayati AA. The importance of single nucleotide polymorphisms in interferon gamma receptor-1 gene in pulmonary patients infected with rapid grower mycobacterium. Int J Mycobacteriol 2016;5 Suppl 1:S210-1.
26Taylor AP, Murray HW. Intracellular antimicrobial activity in the absence of interferon-gamma: Effect of interleukin-12 in experimental visceral leishmaniasis in interferon-gamma gene-disrupted mice. J Exp Med 1997;185:1231-9.
27Chevillard C, Moukoko CE, Elwali NE, Bream JH, Kouriba B, Argiro L, et al. IFN-gamma polymorphisms (IFN-gamma +2109 and IFN-gamma +3810) are associated with severe hepatic fibrosis in human hepatic Schistosomiasis (Schistosoma mansoni). J Immunol 2003;171:5596-601.
28Tadolini M, Codecasa LR, García-García JM, Blanc FX, Borisov S, Alffenaar JW, et al. Active tuberculosis, sequelae and COVID-19 co-infection: First cohort of 49 cases. Eur Respir J 2020;56:2001398.
29Garg N, Im Lee Y. Reactivation TB with severe COVID-19. Chest 2020;158:A777.